Browse wiki
Sequence 1093(rif 1 , rif1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | RAP1 interacting factor homolog ( yeast ) Ensembl: ENSG00000080345 UniGene: Hs.655671 EntrezGene: 55183 Ensembl Chr2: 151974674 - 152042109 Strand: 1 GO terms: 0000781 0001939 0001940 0005524 0005634 0005694 0006974 0007049 0016887 |
Design | SiRNA + |
Name | rif_1 , rif1 + |
Sequence | siRNA sense (21b) CAGCAAGAAATAGCACCTATT / siRNA antisense (21b) TAGGTGCTATTTCTTGCTGTT |
Target | RIF1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
hide properties that link here |
No properties link to this page. |