Browse wiki
| Sequence 1117(hAM-2 , hAM2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | SET domain, bifurcated 1 Ensembl: ENSG00000133321 UniGene: Hs.643565 EntrezGene: 9869 Ensembl Chr11: 63060856 - 63070505 Strand: 1 GO terms: 8287 |
| Design | ShRNA + |
| Name | hAM-2 , hAM2 + |
| Sequence | (47b) ATCACACTCCTGTATCAACTTCAAGAGAGTTGATACAGGAGTGTGAT |
| Target | SETDB1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
| hide properties that link here |
| No properties link to this page. |
