Browse wiki
Sequence 1117(hAM-2 , hAM2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | SET domain, bifurcated 1 Ensembl: ENSG00000133321 UniGene: Hs.643565 EntrezGene: 9869 Ensembl Chr11: 63060856 - 63070505 Strand: 1 GO terms: 8287 |
Design | ShRNA + |
Name | hAM-2 , hAM2 + |
Sequence | (47b) ATCACACTCCTGTATCAACTTCAAGAGAGTTGATACAGGAGTGTGAT |
Target | SETDB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:27 + |
hide properties that link here |
No properties link to this page. |
![Support Doctors Without Borders](http://www.doctorswithoutborders.org/sites/usa/files/button_popup_185x70.png)