Browse wiki

Jump to: navigation, search
Sequence 1126(SLC27A2-Like2-1)
Application Gene silencing +
Chemistry PmGpmGpmApmGpmGpmApmCpmGpmApmGpmGpmApmGpmCpmApmGpmGpmApmGpmCpmApmTpmCpmTpmT +
Design Morpholino +
Name SLC27A2-Like2-1  +
Sequence (25b) GGAGGACGAGGAGCAGGAGCATCTT
Target SLC27A2-Like2-1 ( Danio rerio ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:02  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_1126(SLC27A2-2DLike2-2D1)"