Browse wiki

Jump to: navigation, search
Sequence 1137(hCAP-E (RE-2) , hCAPE (RE2) )
Application Gene silencing +
Chemistry RNA +
Description Structural maintenance of chromosomes 2 E … Structural maintenance of chromosomes 2 Ensembl: ENSG00000136824 UniGene: Hs.119023 EntrezGene: 10592 Ensembl Chr9: 105896362 - 105943519 Strand: 1 GO terms: 0000166 0000228 0000796 0005515 0005524 0005634 0005694 0005737 0006259 0007049 0007067 0007076 0016887 0046982 0051276 005130167 0007076 0016887 0046982 0051276 0051301
Design SiRNA +
Name hCAP-E (RE-2) , hCAPE (RE2)  +
Sequence siRNA sense (21b) CATATTGGACTCCATCTGCTT / siRNA antisense (21b) GCAGATGGAGTCCAATATGTT
Target SMC2 ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:21:29  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders