Browse wiki
| Sequence 1142(CNX9b) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Sorting nexin 9 Ensembl: ENSG00000130340 UniGene: Hs.191213 EntrezGene: 51429 Ensembl Chr6: 158164282 - 158286097 Strand: 1 GO terms: 0005070 0005515 0005625 0005737 0005792 0005886 0006886 0007154 0008104 0035091 |
| Design | SiRNA + |
| Name | CNX9b + |
| Sequence | siRNA sense (21b) CCTACTAACACTAATCGATTT / siRNA antisense (21b) ATCGATTAGTGTTAGTAGGTT |
| Target | SNX9 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:02 + |
| hide properties that link here |
| No properties link to this page. |
