Browse wiki

Jump to: navigation, search
Sequence 1155(SSH1L)
Application Gene silencing +
Chemistry RNA +
Description Slingshot homolog 1 ( Drosophila ) Ensembl: ENSG00000084112 UniGene: Hs.199763 EntrezGene: 54434
Design ShRNA +
Name SSH1L  +
Sequence (49b) TCGTCACCCAAGAAAGATATTCAAGAGATATCTTTCTTGGGTGACGATT
Target SSH1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:09  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders