Browse wiki
Sequence 1156() |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Slingshot homolog 1 ( Drosophila ) Ensembl: ENSG00000084112 UniGene: Hs.199763 EntrezGene: 54434 |
Design | ShRNA + |
Sequence | (49b) TCGTCACCCAAGAAAGATATTCAAGAGATATCTTTCTTGGGTGACGATT |
Target | SSH1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:13 + |
hide properties that link here |
No properties link to this page. |