Browse wiki
| Sequence 1158(SSH1L-mut , SSH1Lmut) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Slingshot homolog 1 ( Drosophila ) Ensembl: ENSG00000084112 UniGene: Hs.199763 EntrezGene: 54434 |
| Design | ShRNA + |
| Name | SSH1L-mut , SSH1Lmut + |
| Sequence | (49b) TCTTCCCCCAAGAAAGATATTCAAGAGATATCTTTCTTGGGGGAAGATT |
| Target | SSH1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:58 + |
| hide properties that link here |
| No properties link to this page. |
