Browse wiki
| Sequence 1162(SSU05 0075) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Design | Primer set + |
| Name | SSU05_0075 + |
| Sequence | Forward PCR primer (20b) AGGACAACGAACACGGTAAC / Reverse PCR primer (21b) CAAATGCTCATCGACGAAAGG |
| Target | SSU05 0075 ( Streptococcus suis ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:24 + |
| hide properties that link here |
| No properties link to this page. |
