Browse wiki
Sequence 1163(SSU05 0076) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Design | Primer set + |
Name | SSU05_0076 + |
Sequence | Forward PCR primer (19b) AGCAGACGCAATCGCAATC / Reverse PCR primer (22b) GCTTCGCTGACTACCAAGTTAG |
Target | SSU05 0076 ( Streptococcus suis ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:13 + |
hide properties that link here |
No properties link to this page. |