Browse wiki
Sequence 1179(b3a2 4) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | SGT1, suppressor of G2 allele of SKP1 ( S. … SGT1, suppressor of G2 allele of SKP1 ( S. cerevisiae ) Ensembl: ENSG00000074803 UniGene: Hs.281902 EntrezGene: 10910 Ensembl Chr15: 46285791 - 46383567 Strand: 1 GO terms: 0004413 0005215 0005515 0005524 0005624 0005886 0006566 0006810 0006811 0006813 0006814 0006821 0006835 0008152 0008511 0015293 0015377 0016020 0016021 0016740 0017153 0030955 003140220 0016021 0016740 0017153 0030955 0031402 |
Design | ShRNA + |
Name | b3a2_4 + |
Sequence | (65b) GATCCCCGATTTAAGCAGAGTTCAAATTCAAGAGATTTGAACTCTGCTTAAATCTTTTTTGGAAG |
Target | SUGT1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:14 + |
hide properties that link here |
No properties link to this page. |