Browse wiki

Jump to: navigation, search
Sequence 1185(SytI-2 , SytI2)
Application Gene silencing +
Chemistry RNA +
Description Synaptotagmin I Ensembl: ENSMUSG000000358Synaptotagmin I Ensembl: ENSMUSG00000035864 UniGene: Mm.289702 EntrezGene: 20979 Ensembl Chr10: 107934706 - 108448031 Strand: -1 GO terms: 0005215 0005509 0005515 0005516 0005543 0005544 0005737 0005886 0006810 0007269 0008021 0016020 0016021 0030054 0030141 0030672 0031410 0042734 0042802 0043005 0045202 005075010 0042734 0042802 0043005 0045202 0050750
Design ShRNA +
Name SytI-2 , SytI2  +
Sequence (49b) AGACTTAGGGAAGACCATGTTCAAGAGACATGGTCTTCCCTAAGTCTTT
Target Syt1 ( Mus musculus ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:13  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders