Browse wiki

Jump to: navigation, search
Sequence 118 (CLSTR05550r1 cieg058n12 126)
Application Gene silencing +
Chemistry PmTpmCpmCpmApmTpmTpmGpmTpmTpmApmTpmCpmApmTpmCpmTpmGpmApmCpmApmTpmTpmGpmTpmG +
Design Morpholino +
Name CLSTR05550r1_cieg058n12_126  +
Sequence (25b) TCCATTGTTATCATCTGACATTGTG
Target AK115450 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:59  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_118_(CLSTR05550r1_cieg058n12_126)"