Browse wiki
Sequence 151 (siAct1-3 , siAct13) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | V-akt murine thymoma viral oncogene homolo … V-akt murine thymoma viral oncogene homolog 1 Ensembl: ENSG00000142208 UniGene: Hs.525622 EntrezGene: 207 Ensembl Chr14: 104306734 - 104333125 Strand: -1 GO terms: 0000060 0000166 0001568 0001890 0004672 0004674 0004713 0005351 0005515 0005524 0005634 0005737 0005819 0005886 0005975 0005977 0005978 0006006 0006417 0006464 0006468 0006809 000691506 0006417 0006464 0006468 0006809 0006915 |
Design | SiRNA + |
Name | siAct1-3 , siAct13 + |
Sequence | siRNA sense (21b) CCGCCATCCAGACTGTGGCTT / siRNA antisense (21b) GCCACAGTCTGGATGGCGGTT |
Target | AKT1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:40 + |
hide properties that link here |
No properties link to this page. |