Browse wiki
Sequence 201 (arrestin-2 , arrestin2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Arrestin, beta 2 Ensembl: ENSG00000141480 UniGene: Hs.435811 EntrezGene: 409 Ensembl Chr17: 4560538 - 4571543 Strand: 1 GO terms: 0001932 0005515 0005622 0005634 0005737 0005886 0007165 0007600 0008277 0050896 |
Design | SiRNA + |
Name | arrestin-2 , arrestin2 + |
Sequence | siRNA sense (21b) GGACCGCAAAGTGTTTGTGTT / siRNA antisense (21b) CACAAACACTTTGCGGTCCTT |
Target | ARRB2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:31 + |
hide properties that link here |
No properties link to this page. |