Browse wiki
| Sequence 202 (b-arrestin(ineffective), barrestin(ineffective) ) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Arrestin, beta 2 Ensembl: ENSG00000141480 UniGene: Hs.435811 EntrezGene: 409 Ensembl Chr17: 4560538 - 4571543 Strand: 1 GO terms: 0001932 0005515 0005622 0005634 0005737 0005886 0007165 0007600 0008277 0050896 |
| Design | SiRNA + |
| Name | b-arrestin(ineffective), barrestin(ineffective) + |
| Sequence | siRNA sense (21b) GTGGACCCTGTAGATGGCGTT / siRNA antisense (21b) CGCCATCTACAGGGTCCACTT |
| Target | ARRB2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:21 + |
| hide properties that link here |
| No properties link to this page. |
