Browse wiki
Sequence 244 (siSARS-TRS , siSARSTRS) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Design | SiRNA + |
Name | siSARS-TRS , siSARSTRS + |
Sequence | siRNA sense (21b) ATCTGTTCTCTAAACGAACTT / siRNA antisense (21b) GTTCGTTTAGAGAACAGATTT |
Target | AY310120.1 ( SARS coronavirus FRA ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:55 + |
hide properties that link here |
No properties link to this page. |