Browse wiki
Sequence 297 (si 087) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | BCL2-like 1 Ensembl: ENSG00000084234 UniG … BCL2-like 1 Ensembl: ENSG00000084234 UniGene: Hs.516966 EntrezGene: 598 Ensembl Chr11: 129445011 - 129519910 Strand: 1 GO terms: 0001967 0003677 0004867 0005488 0005515 0005634 0006878 0007186 0007617 0007626 0009790 0016020 0016021 0030198 0030900 0030901 0042309 0050825 0050826 005088500 0030901 0042309 0050825 0050826 0050885 |
Design | SiRNA + |
Name | si_087 + |
Sequence | siRNA sense (21b) CAGAGACGAGACTCAGTGAGT / siRNA antisense (21b) TCACTGAGTCTCGTCTCTGGT |
Target | BCL2L1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:59 + |
hide properties that link here |
No properties link to this page. |