Browse wiki

Jump to: navigation, search
Sequence 354 (p21-siRNA255 , p21siRNA255)
Application Gene silencing +
Chemistry RNA +
Description Cyclin-dependent kinase inhibitor 1A ( p21Cyclin-dependent kinase inhibitor 1A ( p21, Cip1 ) Ensembl: ENSG00000124762 UniGene: Hs.370771 EntrezGene: 1026 Ensembl Chr6: 36754465 - 36763086 Strand: 1 GO terms: 0000074 0000307 0004672 0004861 0005634 0005737 0005829 0006974 0007049 0007050 0008270 0008285 0008629 0009411 0016301 0030332 0030890 0043066 0043071 0045736 004687232 0030890 0043066 0043071 0045736 0046872
Design ShRNA +
Name p21-siRNA255 , p21siRNA255  +
Sequence (49b) CTTCGACTTTGTCACCGAGTTCAAGAGACTCGGTGACAAAGTCGAAGTT
Target CDKN1A ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:40  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders