Browse wiki
| Sequence 355 (p21-siRNA400 , p21siRNA400) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Cyclin-dependent kinase inhibitor 1A ( p21 … Cyclin-dependent kinase inhibitor 1A ( p21, Cip1 ) Ensembl: ENSG00000124762 UniGene: Hs.370771 EntrezGene: 1026 Ensembl Chr6: 36754465 - 36763086 Strand: 1 GO terms: 0000074 0000307 0004672 0004861 0005634 0005737 0005829 0006974 0007049 0007050 0008270 0008285 0008629 0009411 0016301 0030332 0030890 0043066 0043071 0045736 004687232 0030890 0043066 0043071 0045736 0046872 |
| Design | ShRNA + |
| Name | p21-siRNA400 , p21siRNA400 + |
| Sequence | (49b) GACCATGTGGACCTGTCACTTCAAGAGAGTGACAGGTCCACATGGTCTT |
| Target | CDKN1A ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:34 + |
| hide properties that link here |
| No properties link to this page. |
