Browse wiki
| Sequence 381 (CRISPLD2) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Cysteine-rich secretory protein LCCL domain containing 2 Ensembl: ENSG00000103196 UniGene: Hs.513779 EntrezGene: 83716 Ensembl Chr16: 83411113 - 83500614 Strand: 1 GO terms: 0005576 0030133 0030324 |
| Design | Primer set + |
| Name | CRISPLD2 + |
| Sequence | Forward PCR primer (22b) CTCAGCAAATACAAACCTTCCA / Reverse PCR primer (18b) GGTCGTGTAGCAGTCCAA |
| Target | CRISPLD2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:01 + |
| hide properties that link here |
| No properties link to this page. |
