Browse wiki
Sequence 388 (Csk455) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Tyrosine-protein kinase Ensembl: ENSG0000 … Tyrosine-protein kinase Ensembl: ENSG00000103653 UniGene: Hs.77793 EntrezGene: 2444 Ensembl Chr15: 72861768 - 72882557 Strand: 1 GO terms: 0000074 0000166 0004672 0004674 0004713 0005515 0005524 0005737 0005886 0005911 0006468 0007242 0008022 0008285 001674011 0006468 0007242 0008022 0008285 0016740 |
Design | SiRNA + |
Name | Csk455 + |
Sequence | siRNA sense (21b) ATTGCCAAGTACAACTTCCAC / siRNA antisense (21b) GGAAGTTGTACTTGGCAATAC |
Target | CSK ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:36 + |
hide properties that link here |
No properties link to this page. |