Browse wiki
| Sequence 407 (si 038) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Casein kinase 2, alpha 1 polypeptide Ensembl: ENSG00000101266 UniGene: Hs.701971 EntrezGene: 1457 |
| Design | SiRNA + |
| Name | si_038 + |
| Sequence | siRNA sense (21b) AAAGACCCTGTGTCACGAACC / siRNA antisense (21b) TTCGTGACACAGGGTCTTTTA |
| Target | CSNK2A1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:13 + |
| hide properties that link here |
| No properties link to this page. |
