Browse wiki
Sequence 428 (si 029) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Casein kinase 2, beta polypeptide Ensembl: ENSG00000204435 |
Design | SiRNA + |
Name | si_029 + |
Sequence | siRNA sense (21b) ACAUGCUCUUCAUGGUGCAUC / siRNA antisense (21b) UGCACCAUGAAGAGCAUGUGA |
Target | CSNK2B ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:59 + |
hide properties that link here |
No properties link to this page. |