Browse wiki
| Sequence 429 (si 030) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Casein kinase 2, beta polypeptide Ensembl: ENSG00000204435 |
| Design | SiRNA + |
| Name | si_030 + |
| Sequence | siRNA sense (21b) CAGUCAAGACGAUUCGCUGAU / siRNA antisense (21b) CAGCGAAUCGUCUUGACUGGG |
| Target | CSNK2B ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:58 + |
| hide properties that link here |
| No properties link to this page. |
