Browse wiki
Sequence 437 (ctr) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Catenin ( cadherin-associated protein ), b … Catenin ( cadherin-associated protein ), beta 1, 88kDa Ensembl: ENSG00000168036 UniGene: Hs.476018 EntrezGene: 1499 Ensembl Chr3: 41216000 - 41256938 Strand: 1 GO terms: 0000122 0000904 0001501 0001569 0001706 0001708 0001709 0001711 0001837 0003682 0003690 0003700 0003713 0004871 0005198 0005624 0005634 0005667 0005737 0005856 0005886 0005916 000726867 0005737 0005856 0005886 0005916 0007268 |
Design | SiRNA + |
Name | ctr + |
Sequence | siRNA sense (21b) GACGTGGGACTGAAGGGGTTT / siRNA antisense (21b) ACCCCTTCAGTCCCACGTCTT |
Target | CTNNB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:09 + |
hide properties that link here |
No properties link to this page. |