Browse wiki
Sequence 442 (siCXCR4) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Chemokine ( C-X-C motif ) receptor 4 Ense … Chemokine ( C-X-C motif ) receptor 4 Ensembl: ENSG00000121966 UniGene: Hs.593413 EntrezGene: 7852 Ensembl Chr2: 136588909 - 136589979 Strand: -1 GO terms: 0000187 0001569 0001584 0001667 0001764 0003779 0004918 0004945 0004947 0004950 0005515 0005737 0005886 0005887 0006915 0006935 0006954 0006955 0007165 0007186 0007204 0007281 000742055 0007165 0007186 0007204 0007281 0007420 |
Design | SiRNA + |
Name | siCXCR4 + |
Sequence | siRNA sense (21b) GCATGACGGACAAGTACAGTT / siRNA antisense (21b) CTGTACTTGTCCGTCATGCTT |
Target | CXCR4 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:11 + |
hide properties that link here |
No properties link to this page. |