Browse wiki
| Sequence 459 (Eteplirsen , AVI4658 , AVI-4658) |
| Application | Exon skipping + |
|---|---|
| Chemistry | PmCpmTpmCpmCpmApmApmCpmApmTpmCpmApmApmGpmGpmApmApmGpmApmTpmGpmGpmCpmApmTpmTpmTpmCpmTpmApmG + |
| Description | Dystrophin ( muscular dystrophy, Duchenne and Becker types ) Ensembl: ENSG00000079112 |
| Design | Exon 51-targeted morpholino + |
| Name | Eteplirsen , AVI4658 , AVI-4658 + |
| Sequence | CTCCAACATCAAGGAAGATGGCATTTCTAG |
| Target | DMD ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 21:26:12 + |
| hide properties that link here |
| No properties link to this page. |
