Browse wiki
Sequence 489 (si 058) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) Ensembl: ENSG00000012061 |
Design | SiRNA + |
Name | si_058 + |
Sequence | siRNA sense (21b) GGGGCAAUCCCGUACUGAAGU / siRNA antisense (21b) UUCAGUACGGGAUUGCCCCUC |
Target | ERCC1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:14 + |
hide properties that link here |
No properties link to this page. |