Browse wiki
Sequence 492 (si 062) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Excision repair cross-complementing rodent … Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) Ensembl: ENSG00000013441 UniGene: Hs.487294 EntrezGene: 2068 Ensembl Chr2: 201416164 - 201437667 Strand: -1 GO terms: 0000074 0000166 0004672 0004674 0004713 0004715 0005524 0005634 0006468 0008283 001674015 0005524 0005634 0006468 0008283 0016740 |
Design | SiRNA + |
Name | si_062 + |
Sequence | siRNA sense (21b) AAAGTTGCTCAACTTCTATGA / siRNA antisense (21b) ATAGAAGTTGAGCAACTTTCG |
Target | ERCC2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:36 + |
hide properties that link here |
No properties link to this page. |