Browse wiki
Sequence 524 (fas 4) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Fas ( TNF receptor superfamily member 6 ) … Fas ( TNF receptor superfamily member 6 ) Ensembl: ENSMUSG00000024778 UniGene: Mm.1626 EntrezGene: 14102 Ensembl Chr19: 34365156 - 34402260 Strand: 1 GO terms: 0004872 0004888 0005515 0006915 0006924 0006925 0006927 0006955 0007165 0008625 0009897 0016020 0016021 0043065 004506025 0009897 0016020 0016021 0043065 0045060 |
Design | SiRNA + |
Name | fas_4 + |
Sequence | siRNA sense (21b) ATCGCCTATGGTTGTTGACTT / siRNA antisense (21b) GTCAACAACCATAGGCGATTT |
Target | Fas ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:53 + |
hide properties that link here |
No properties link to this page. |