Browse wiki
Sequence 536 (SytIX-1 , SytIX1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Fizzy/cell division cycle 20 related 1 ( D … Fizzy/cell division cycle 20 related 1 ( Drosophila ) Ensembl: ENSG00000105325 UniGene: Hs.413133 EntrezGene: 51343 Ensembl Chr19: 3473954 - 3489325 Strand: 1 GO terms: 0000074 0005515 0005634 0005680 0005737 0006511 0006512 0007049 0007067 0008047 005130111 0006512 0007049 0007067 0008047 0051301 |
Design | ShRNA + |
Name | SytIX-1 , SytIX1 + |
Sequence | (49b) AATGGATGTAGGAGGACTCTTCAAGAGAGAGTCCTCCTACATCCATTTT |
Target | FZR1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:17 + |
hide properties that link here |
No properties link to this page. |