Browse wiki

Jump to: navigation, search
Sequence 538 (SytIX-3 , SytIX3)
Application Gene silencing +
Chemistry RNA +
Description Fizzy/cell division cycle 20 related 1 ( DFizzy/cell division cycle 20 related 1 ( Drosophila ) Ensembl: ENSG00000105325 UniGene: Hs.413133 EntrezGene: 51343 Ensembl Chr19: 3473954 - 3489325 Strand: 1 GO terms: 0000074 0005515 0005634 0005680 0005737 0006511 0006512 0007049 0007067 0008047 005130111 0006512 0007049 0007067 0008047 0051301
Design ShRNA +
Name SytIX-3 , SytIX3  +
Sequence (49b) CACCCTGAACCCCTATTACTTCAAGAGAGTAATAGGGGTTCAGGGTGTT
Target FZR1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:08  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders