Browse wiki
Sequence 580 (si 120) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Histone deacetylase 6 Ensembl: ENSG000000 … Histone deacetylase 6 Ensembl: ENSG00000094631 UniGene: Hs.6764 EntrezGene: 10013 Ensembl ChrX: 48545170 - 48568336 Strand: 1 GO terms: 0000118 0000209 0003779 0004407 0005515 0005634 0005737 0005874 0006350 0006355 0006476 0007026 0007049 0007275 0008270 0016566 0016568 0016575 0016787 0042826 0042903 004687268 0016575 0016787 0042826 0042903 0046872 |
Design | SiRNA + |
Name | si_120 + |
Sequence | siRNA sense (21b) GCACAGGCTTCACCGTCAACG / siRNA antisense (21b) TTGACGGTGAAGCCTGTGCCC |
Target | HDAC6 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:41 + |
hide properties that link here |
No properties link to this page. |