Browse wiki
| Sequence 617 (HLA-A) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Major histocompatibility complex, class I, A Ensembl: ENSG00000206503 UniGene: Hs.652059 , Hs.661049 EntrezGene: 4931 Ensembl Chr6: 30017016 - 30021640 Strand: 1 GO terms: 0002474 0005515 0005887 0006955 0016020 0016021 0019882 0032393 0042612 |
| Design | Primer set + |
| Name | HLA-A + |
| Sequence | Forward PCR primer (23b) AAAAGGAGGGAGTTACACTCAGG / Reverse PCR primer (21b) GCTGTGAGGGACACATCAGAG |
| Target | HLA-A ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:03 + |
| hide properties that link here |
| No properties link to this page. |
