Browse wiki
| Sequence 620 (HLA-B) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Major histocompatibility complex, class I, B Ensembl: ENSG00000204523 UniGene: Hs.77961 EntrezGene: 3106 Ensembl Chr6: 31429632 - 31432914 Strand: -1 GO terms: 0002474 0005515 0005887 0006955 0016020 0016021 0019882 0032393 0042612 |
| Design | Primer set + |
| Name | HLA-B + |
| Sequence | Forward PCR primer (24b) TTGTTGCTGGCCTGGCTGTCCTAG / Reverse PCR primer (24b) CCCTCCTTTTCCACCTGAACTCTT |
| Target | HLA-B ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:01 + |
| hide properties that link here |
| No properties link to this page. |
