Browse wiki
Sequence 622 (HLA-DPB) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Major histocompatibility complex, class II, DP beta 1 Ensembl: ENSG00000112242 |
Design | Primer set + |
Name | HLA-DPB + |
Sequence | Forward PCR primer (24b) TTCTACCCAGGCAGCATTCAAGTC / Reverse PCR primer (24b) GTCATTTCCAGCATCACCAGGATC |
Target | HLA-DPB1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:05 + |
hide properties that link here |
No properties link to this page. |