Browse wiki
| Sequence 624 (HLA-DRA) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Major histocompatibility complex, class II, DR alpha Ensembl: ENSG00000143768 |
| Design | Primer set + |
| Name | HLA-DRA + |
| Sequence | Forward PCR primer (24b) TGTGGATATGGCAAAGAAGGAGAC / Reverse PCR primer (25b) GGAGGTACATTGGTGATCGGAGTAT |
| Target | HLA-DRA ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:15 + |
| hide properties that link here |
| No properties link to this page. |
