Browse wiki
Sequence 650 (siRNAB) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Integrin-linked kinase Ensembl: ENSG00000 … Integrin-linked kinase Ensembl: ENSG00000166333 UniGene: Hs.5158 EntrezGene: 3611 Ensembl Chr11: 6581540 - 6588673 Strand: 1 GO terms: 0000166 0001658 0004672 0004674 0004713 0005515 0005524 0005737 0005925 0006468 0007160 0007229 0008283 0008284 0016740 0030054 004519729 0008283 0008284 0016740 0030054 0045197 |
Design | SiRNA + |
Name | siRNAB + |
Sequence | siRNA sense (21b) AGAGGGCCTTCAAGCGCCATT / siRNA antisense (21b) TGGCGCTTGAAGGCCCTCTTT |
Target | ILK ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:08 + |
hide properties that link here |
No properties link to this page. |