Browse wiki

Jump to: navigation, search
Sequence 66 (CLSTR05721r1 cilv013n20 131)
Application Gene silencing +
Chemistry PmCpmTpmGpmTpmGpmTpmApmApmApmCpmTpmCpmApmGpmApmCpmApmCpmCpmApmTpmCpmApmTpmC +
Design Morpholino +
Name CLSTR05721r1_cilv013n20_131  +
Sequence (25b) CTGTGTAAACTCAGACACCATCATC
Target AK113011 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:34  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_66_(CLSTR05721r1_cilv013n20_131)"