Browse wiki
| Sequence 690 (si 135) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Ligase I, DNA, ATP-dependent Ensembl: ENSG00000144908 UniGene: Hs.1770 EntrezGene: 3978 Ensembl Chr3: 127305098 - 127382719 Strand: -1 GO terms: 0003824 0005737 0006412 0006730 0008152 0008168 0009058 0009258 0016155 0016491 0016742 0048037 |
| Design | SiRNA + |
| Name | si_135 + |
| Sequence | siRNA sense (21b) CGACGGAAAGCGTTTCAGAGC / siRNA antisense (21b) TCTGAAACGCTTTCCGTCGGG |
| Target | LIG1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:32 + |
| hide properties that link here |
| No properties link to this page. |
