Browse wiki

Jump to: navigation, search
Sequence 70 (CLSTR13048r1 cieg035c12 182)
Application Gene silencing +
Chemistry PmTpmCpmTpmTpmGpmGpmApmApmGpmApmTpmTpmCpmTpmTpmTpmTpmGpmGpmCpmApmTpmTpmApmC +
Design Morpholino +
Name CLSTR13048r1_cieg035c12_182  +
Sequence (25b) TCTTGGAAGATTCTTTTGGCATTAC
Target AK113822 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:34  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_70_(CLSTR13048r1_cieg035c12_182)"