Browse wiki

Jump to: navigation, search
Sequence 90 (CLSTR14517r1 cicl060e01 195)
Application Gene silencing +
Chemistry PmCpmGpmCpmApmApmTpmGpmTpmTpmCpmTpmGpmTpmGpmTpmGpmTpmTpmTpmCpmTpmCpmApmTpmA +
Design Morpholino +
Name CLSTR14517r1_cicl060e01_195  +
Sequence (25b) CGCAATGTTCTGTGTGTTTCTCATA
Target AK114531 ( Ciona intestinalis ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:19:28  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders
Retrieved from "http://wikisequences.org/Special:Browse/Sequence_90_(CLSTR14517r1_cicl060e01_195)"