Sequence 1021(ADRP)
From Wikisequences
Sequence ADRP | |
---|---|
Target | PLIN2 ( Homo sapiens ) |
Description | Adipose differentiation-related protein
Ensembl: ENSG00000147872 UniGene: Hs.3416 EntrezGene: 123 Ensembl Chr9: 19105760 - 19117573 Strand: -1 GO terms: 0005576 0005634 0005737 0005783 0005811 0005886 0015909 0016020 0019915 |
Design | primer set |
Chemistry | DNA |
Sequence | Forward PCR primer (25b) CTGAGCACATCGAGTCACATACTCT / Reverse PCR primer (21b) GGAGCGTCTGGCATGTAGTGT |
Application | gene expression |
Name | ADRP |
References
Polyunsaturated fatty acid relatively decreases cholesterol content in THP-1 macrophage-derived foam cell: partly correlates with expression profile of CIDE and PAT members.Song Y, Zhang LJ, Li H, Gu Y, Li FF, Jiang LN, Liu F, Ye J, Li Q.Lipids Health Dis. 2013 Jul 23;12:111. doi: 10.1186/1476-511X-12-111.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478