Browse wiki
| Sequence 1021(ADRP) |
| Application | Gene expression + |
|---|---|
| Chemistry | DNA + |
| Description | Adipose differentiation-related protein Ensembl: ENSG00000147872 UniGene: Hs.3416 EntrezGene: 123 Ensembl Chr9: 19105760 - 19117573 Strand: -1 GO terms: 0005576 0005634 0005737 0005783 0005811 0005886 0015909 0016020 0019915 |
| Design | Primer set + |
| Name | ADRP + |
| Sequence | Forward PCR primer (25b) CTGAGCACATCGAGTCACATACTCT / Reverse PCR primer (21b) GGAGCGTCTGGCATGTAGTGT |
| Target | PLIN2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:47 + |
| hide properties that link here |
| No properties link to this page. |
