Browse wiki

Jump to: navigation, search
Sequence 1021(ADRP)
Application Gene expression +
Chemistry DNA +
Description Adipose differentiation-related protein Ensembl: ENSG00000147872 UniGene: Hs.3416 EntrezGene: 123 Ensembl Chr9: 19105760 - 19117573 Strand: -1 GO terms: 0005576 0005634 0005737 0005783 0005811 0005886 0015909 0016020 0019915
Design Primer set +
Name ADRP  +
Sequence Forward PCR primer (25b) CTGAGCACATCGAGTCACATACTCT / Reverse PCR primer (21b) GGAGCGTCTGGCATGTAGTGT
Target PLIN2 ( Homo sapiens ) +
Categories Sequence  +
Modification┬ádateThis property is a special property in this wiki. 2 March 2015 02:20:47  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders