Sequence 1041(PKCa)

From Wikisequences
Jump to: navigation, search
Sequence PKCa
Target Prkca ( Mus musculus )
Description Protein kinase C, alpha

Ensembl: ENSMUSG00000050965 UniGene: Mm.222178 EntrezGene: 18750 Ensembl Chr11: 107799562 - 108205068 Strand: -1 GO terms: 0000166 0000188 0001933 0001934 0002026 0004672 0004674 0004698 0004713 0005509 0005515 0005524 0005634 0005737 0005739 0006468 0006469 0006874 0006937 0007242 0008270 0008629 0016740

Design siRNA
Chemistry RNA
Sequence siRNA sense (21b) ACAACCTGGACAGAGTGAATT / siRNA antisense (21b) TTCACTCTGTCCAGGTTGTTT
Application gene silencing
Name PKCa

References

Epidermal growth factor induces fibroblast contractility and motility via a protein kinase C delta-dependent pathway.Iwabu A, Smith K, Allen FD, Lauffenburger DA, Wells A.J Biol Chem. 2004 Apr 9;279(15) :14551-60. Epub 2004 Jan 27. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders