Sequence 1041(PKCa)
Sequence PKCa | |
---|---|
Target | Prkca ( Mus musculus ) |
Description | Protein kinase C, alpha
Ensembl: ENSMUSG00000050965 UniGene: Mm.222178 EntrezGene: 18750 Ensembl Chr11: 107799562 - 108205068 Strand: -1 GO terms: 0000166 0000188 0001933 0001934 0002026 0004672 0004674 0004698 0004713 0005509 0005515 0005524 0005634 0005737 0005739 0006468 0006469 0006874 0006937 0007242 0008270 0008629 0016740 |
Design | siRNA |
Chemistry | RNA |
Sequence | siRNA sense (21b) ACAACCTGGACAGAGTGAATT / siRNA antisense (21b) TTCACTCTGTCCAGGTTGTTT |
Application | gene silencing |
Name | PKCa |
References
Epidermal growth factor induces fibroblast contractility and motility via a protein kinase C delta-dependent pathway.Iwabu A, Smith K, Allen FD, Lauffenburger DA, Wells A.J Biol Chem. 2004 Apr 9;279(15) :14551-60. Epub 2004 Jan 27.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
