Browse wiki

Jump to: navigation, search
Sequence 1041(PKCa)
Application Gene silencing +
Chemistry RNA +
Description Protein kinase C, alpha Ensembl: ENSMUSG0 … Protein kinase C, alpha Ensembl: ENSMUSG00000050965 UniGene: Mm.222178 EntrezGene: 18750 Ensembl Chr11: 107799562 - 108205068 Strand: -1 GO terms: 0000166 0000188 0001933 0001934 0002026 0004672 0004674 0004698 0004713 0005509 0005515 0005524 0005634 0005737 0005739 0006468 0006469 0006874 0006937 0007242 0008270 0008629 001674074 0006937 0007242 0008270 0008629 0016740
Design SiRNA +
Name PKCa  +
Sequence siRNA sense (21b) ACAACCTGGACAGAGTGAATT / siRNA antisense (21b) TTCACTCTGTCCAGGTTGTTT
Target Prkca ( Mus musculus ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:20:59  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders