Browse wiki
| Sequence 1041(PKCa) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Protein kinase C, alpha Ensembl: ENSMUSG0 … Protein kinase C, alpha Ensembl: ENSMUSG00000050965 UniGene: Mm.222178 EntrezGene: 18750 Ensembl Chr11: 107799562 - 108205068 Strand: -1 GO terms: 0000166 0000188 0001933 0001934 0002026 0004672 0004674 0004698 0004713 0005509 0005515 0005524 0005634 0005737 0005739 0006468 0006469 0006874 0006937 0007242 0008270 0008629 001674074 0006937 0007242 0008270 0008629 0016740 |
| Design | SiRNA + |
| Name | PKCa + |
| Sequence | siRNA sense (21b) ACAACCTGGACAGAGTGAATT / siRNA antisense (21b) TTCACTCTGTCCAGGTTGTTT |
| Target | Prkca ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:59 + |
| hide properties that link here |
| No properties link to this page. |
