Browse wiki
Sequence 1041(PKCa) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Protein kinase C, alpha Ensembl: ENSMUSG0 … Protein kinase C, alpha Ensembl: ENSMUSG00000050965 UniGene: Mm.222178 EntrezGene: 18750 Ensembl Chr11: 107799562 - 108205068 Strand: -1 GO terms: 0000166 0000188 0001933 0001934 0002026 0004672 0004674 0004698 0004713 0005509 0005515 0005524 0005634 0005737 0005739 0006468 0006469 0006874 0006937 0007242 0008270 0008629 001674074 0006937 0007242 0008270 0008629 0016740 |
Design | SiRNA + |
Name | PKCa + |
Sequence | siRNA sense (21b) ACAACCTGGACAGAGTGAATT / siRNA antisense (21b) TTCACTCTGTCCAGGTTGTTT |
Target | Prkca ( Mus musculus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:59 + |
hide properties that link here |
No properties link to this page. |
![Support Doctors Without Borders](http://www.doctorswithoutborders.org/sites/usa/files/button_popup_185x70.png)