Sequence 1055(RAB12)

From Wikisequences
Jump to: navigation, search
Sequence RAB12
Target RAB12 ( Homo sapiens )
Description RAB12, member RAS oncogene family

Ensembl: ENSG00000206418 UniGene: Hs.270074 EntrezGene: 201475 Ensembl Chr18: 8599443 - 8629380 Strand: 1 GO terms: 0000166 0003777 0003924 0005515 0005524 0005525 0005622 0005794 0005875 0006886 0006913 0007018 0007165 0007264 0015031 0016020

Design primer set
Chemistry DNA
Sequence Forward PCR primer (20b) TGCGGTTCTGTGAAGCAAGT / Reverse PCR primer (20b) CAACAGCATCGGACATGTGG
Application gene expression
Name RAB12

References

Long-term cultured mesenchymal stem cells frequently develop genomic mutations but do not undergo malignant transformation.Wang Y, Zhang Z, Chi Y, Zhang Q, Xu F, Yang Z, Meng L, Yang S, Yan S, Mao A, Zhang J, Yang Y, Wang S, Cui J, Liang L, Ji Y, Han ZB, Fang X, Han ZC.Cell Death Dis. 2013 Dec 5;4:e950. doi: 10.1038/cddis.2013.480. Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Comments

Background

Support Doctors Without Borders