Sequence 1120(siSFN.2)
From Wikisequences
| Sequence siSFN.2 | |
|---|---|
| Target | SFN (Homo sapiens) |
| Description | Stratifin
Ensembl: ENSG00000175793 UniGene: Hs.523718 EntrezGene: 2810 Ensembl Chr1: 27062240 - 27063534 Strand: 1 GO terms: 0000074 0000079 0001836 0005615 0005737 0006469 0007165 0008283 0008426 0008630 0008632 0019904 0030216 0043154 0043588 |
| Design | siRNA |
| Chemistry | RNA |
| Sequence | siRNA sense (21b) GGGAGAAGGTGGAGACTGATT / siRNA antisense (21b) TCAGTCTCCACCTTCTCCCGG |
| Application | gene silencing |
| Name | siSFN.2 |
References
Multiplexing siRNAs to compress RNAi-based screen size in human cells. Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Nucleic Acids Res. 2007;35(8):e57.
Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478
Comments
Background
