Sequence 1154(siSRP72b)

Sequence siSRP72b
Target	SRP72 ( Homo sapiens )
Description	Signal recognition particle 72kDa Ensembl: ENSG00000174780 UniGene: Hs.237825 EntrezGene: 6731 Ensembl Chr4: 57028519 - 57064603 Strand: 1 GO terms: 0000786 0003677 0004871 0005488 0005634 0006334 0006468 0006614 0007165 0008312 0016301 0048500
Design	siRNA
Chemistry	RNA
Sequence	siRNA sense (21b) GGAGCTTTATGGACAAGTGTT / siRNA antisense (21b) CACTTGTCCATAAAGCTCCTT
Application	gene silencing
Name	siSRP72b

References

Differential regulation of the TRAIL death receptors DR4 and DR5 by the signal recognition particle.Ren YG, Wagner KW, Knee DA, Aza-Blanc P, Nasoff M, Deveraux QL.Mol Biol Cell. 2004 Nov;15(11) :5064-74. Epub 2004 Sep 8.

Intrathecal Injections in Children With Spinal Muscular Atrophy: Nusinersen Clinical Trial Experience. Hache M, Swoboda KJ, Sethna N, Farrow-Gillespie A, Khandji A, Xia S, Bishop KM. J Child Neurol. 2016 Jun;31(7):899-906. PubMed:26823478

Background

Description. The SRP72 gene encodes the 72-kD subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of proteins to the endoplasmic reticulum (ER). The complex consists of a 7S (or 7SL) RNA and 6 different proteins, SRP9 (600707), SRP14 (600708), SRP19 (182175), SRP54 (604857), SRP68 (604858), and SRP72. The proteins are bound to the 7S RNA as monomers (SRP19 and SRP54) or heterodimers (SRP9/SRP14 and SRP68/SRP72). SRP9 and SRP14 constitute the Alu domain of 7S, whereas the other 4 proteins belong to the S domain. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein (summary by Lutcke et al., 1993).